Diethyl ether (BH code 281326G, VWR, Poole, Dorset, UK) was dripped throughout the extraction thimble until the solvent was clear in the tube. ), Arimantas Lionikas (A.L. Trends Biotechnol. A mutant lacking acetyl-CoA synthetase exhibited no induction of the glyoxylate pathway in the presence of acetate, although acetate uptake was normal. C2C12 muscle cells were treated either with control shRNA (Con shRNA) or Cs shRNA which targeted, Palmitate-induced lipotoxicity in C2C12 muscle cells (Cont). Although in eukaryotes it is a mitochondrial enzyme, and in fact, is often used as a enzyme marker for intact mitochondria, it is encoded by nuclear DNA. The cells were then washed three times in PBS to remove all the excess dye. qualify as authors of the study. Pelliccione N, Jaffin B, Sobel ME, Krulwich TA. A final blood sample was taken approximately 48 h later to estimate isotope elimination rates. Secondly, crystal violet staining was applied [39]. COVID-19 is an emerging, rapidly evolving situation. The values are means ± SD (. Blood samples were taken after 1 h of isotope equilibration to estimate initial isotope enrichments and were also collected from unlabelled animals to estimate the background isotope enrichments. L.M.V., Y.A., A.L., and A.R. Virus was harvested in the culture supernatant at 72 h posttransfection, and transductions of C2C12 cells were carried out in the presence of 10 mg l−1 of polybrene. Mol Microbiol. Quantification of immunoblots from six experiments. In experiments with glucose (G experiments), the differentiated Cs shRNA and Con shRNA myotubes were incubated in the differentiation media supplemented with 2% (wt/vol) fatty acid-free BSA and 1.2 mM L carnitine for up to 18 h. In experiments with mixture of glucose and palmitate (G + P experiments), 0.8 mM palmitate was added to the media. [. NIH The data are presented for the baseline period of high carbohydrate diet (HCD) feeding followed by HFD feeding for 2 weeks (HFD2), 6 weeks (HFD6), and 12 weeks (HFD12). The results indicate a role for acetyl-CoA as inducer of the glyoxylate pathway. A citrate‐synthase‐deficient mutant had the following properties: (a) high constitutive levels of glyoxylate pathway enzymes on various substrates, while such levels were only found in the … The images were quantified using Image J (NIH, USA) software. For these experiments, 2 × 106 cells were seeded in six well plates coated with extracellular matrix gel (E6909, Sigma-Aldrich, MO, USA) and containing 2 ml of the growth medium. Values were expressed as means ± SD unless otherwise indicated. Intensity of the sample staining was then assessed using Image J software (National Institute of Health, USA) by measuring the difference in intensities between red and blue colours. Most cases present with neonatal-onset hypotonia, lactic acidosis, hyperammonemia, hypertrophic cardiomyopathy, and 3-methylglutaconic aciduria. Mice were anesthetized by inhalation of a mixture of isoflurane and oxygen for the duration of the scan (∼3 min). A. Duarte, A. M. Zergeroglu, and H. A. Demirel, “Mitochondrial signaling contributes to disuse muscle atrophy,”, J. M. Kristensen, V. Skov, S. J. Petersson et al., “A PGC-1, S. Larsen, J. Nielsen, C. N. Hansen et al., “Biomarkers of mitochondrial content in skeletal muscle of healthy young human subjects,”, R. A. Jacobs, V. Díaz, A.-K. Meinild, M. Gassmann, and C. Lundby, “The C57Bl/6 mouse serves as a suitable model of human skeletal muscle mitochondrial function,”, A. Ratkevicius, A. M. Carroll, A. Kilikevicius et al., “H55N polymorphism as a likely cause of variation in citrate synthase activity of mouse skeletal muscle,”, A. Kilikevicius, T. Venckunas, R. Zelniene et al., “Divergent physiological characteristics and responses to endurance training among inbred mouse strains,”, M. Gaster, A. C. Rustan, V. Aas, and H. Beck-Nielsen, “Reduced lipid oxidation in skeletal muscle from type 2 diabetic subjects may be of genetic origin: evidence from cultured myotubes,”, N. Ørtenblad, M. Mogensen, I. Petersen et al., “Reduced insulin-mediated citrate synthase activity in cultured skeletal muscle cells from patients with type 2 diabetes: evidence for an intrinsic oxidative enzyme defect,”, C. Henique, A. Mansouri, G. Fumey et al., “Increased mitochondrial fatty acid oxidation is sufficient to protect skeletal muscle cells from palmitate-induced apoptosis,”, D.-H. Han, C. Hancock, S.-R. Jung, and J. O. Holloszy, “Is “fat-induced” muscle insulin resistance rapidly reversible?”, S. F. Leibowitz, J. Alexander, J. T. Dourmashkin, J. O. Hill, E. C. Gayles, and G.-Q. Pyruvate Dehydrogenase Complex Deficiency The PDH complex converts pyruvate, which is derived from the catabolism of glucose, to acetyl-CoA, which enters the TCA cycle at citrate … Please enable it to take advantage of the complete set of features! This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Analysis of covariance (ANCOVA), with body mass as a covariate, was applied to RMR, DEE, and MEI data. Genomic DNA was extracted from muscle tissue obtained of B6.A as well as B6 and A/J, to provide positive control, using the hot sodium hydroxide and Tris (HotSHOT) method [36] Genomic segments flanking four SNPs partitioning the region of interest and polymorphic between the B6 and A/J strains were amplified by PCR using pairs of primers provided in parenthesis; rs29356783 (forward-AAGAGGAAGAGCCGAAAAGG; reverse-TAGGCATGATCAAGCACGAG), rs232632450 (GGGAATCAAACCCAGATCCT; ATGTGGGTCCCAGAAATCAA), rs48666233 (TAAATTTCAGGCGAGCTGGT; GCCTTTTCTTTCCTCCGTCT) and rs45825880 (TCCTTGTCGAGCTCCTCCTA; CCTCTTGGGAGGAAACAAGG). … Afterwards 100 μl of the lysis buffer (50 mM tris hydroxymethyl aminomethane-hydrocloride, 1 mM ethylene diamine tetracetic acid, 1 mM ethylene glycol tetra acetic acid, 1% (vol/vol) Triton X-100, 0.1% (vol/vol) 2-mercaptoethanol, 10 mM β-glycerophosphate, 50 mM NaF, and 0.5 mM Na3VO4, 2% (vol/vol) protease inhibitor cocktail, pH of 7.5) was applied to lyse the cells. 1979 Mar 15;95(1):69-75. doi: 10.1111/j.1432-1033.1979.tb12940.x. Eur J Biochem. Levy, and D. S. Fredrickson, “Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge,”, G. E. Truett, P. Heeger, R. L. Mynatt, A. For the CS assay, the molar extinction coefficient used was 13 600 M−1 cm−1 for CoA-5,5′-thiobis(2-nitrobenzoic acid) at 412 nm. edited the manuscript and contributed to the discussion. All authors approved the final version of the manuscript and agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Yosra Alhindi (Y.A), Lobke M. Vaanholt (L.M.V. 12/21) (to A.R. Then, measurements of citrate synthase (CS) and β-hydroxyacyl-coenzyme (CoA) dehydrogenase (HAD) activity were carried out at room temperature of 21°C using the spectrophotometer (GENESYS 10 Bio UV-Vis, Thermo Fisher Scientific Inc., Waltham, MA, USA). citrate synthase (E.C. After transduction, cells were selected in 3 mg l−1 of puromycin for 3 days and then used in the experiments with palmitate incubation. Citrate synthase, a non-iron containing citrate cycle … The crystal violet solution was made by solubilizing 1 g of the dye powder (#C3886, Sigma-Aldrich, St-Louis, MI, USA) in 200 ml of 10% (vol/vol) acetic acid. Extraction of tissue fat was carried out using the Soxhlet method. The homogenates were shaken for 60 min and centrifuged at 13 000 g for 10 min. 95, 69--75]. Pseudoviruses were produced by cotransfecting HEK293 cells with a plasmid carrying shRNA and the Mission lentiviral packaging mix (SH001, Sigma–Aldrich) containing plasmids expressing viral packaging genes and a heterologous viral envelope gene. ), Catherine Hambly (C.H. Firstly, cell counting assay kit-8 (96992, Sigma, UK) was used. Induction of the phosphoenolpyruvate: hexose phosphotransferase system associated with relative anaerobiosis in an obligate aerobe. The CIT1 gene encoding mitochondrial citrate synthase was initially cloned following a screen for mRNAs enriched in polysomes bound to mitochondria (4). Yosra Alhindi is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. The isolated ATP synthase deficiency appears to be a rather frequent mitochondrial disease, and more than 40 patients are known today. Transgene-mediated modifications to animal biochemistry. All the tests were two-tailed with the significance level set at . The enzyme activity was analysed as in our previous studies [6, 20]. ), and European Social Fund under the Global Grant Measure (VP1-3.1-ŠMM-07-K-02-057) (to A.L. Oleate … The digests were separated on 2% agarose gel, imaged, and inspected for presence of the B6 or A/J allele. Y.A wrote the manuscript. A test of the heat dissipation limitation hypothesis in lactating Brandt’s voles (, J. R. Speakman and E. Król, “Comparison of different approaches for the calculation of energy expenditure using doubly labeled water in a small mammal,”, J. Disruption of the gene was found to … Get the latest public health information from CDC: https://www.coronavirus.gov, Get the latest research information from NIH: https://www.nih.gov/coronavirus, Find NCBI SARS-CoV-2 literature, sequence, and clinical content: https://www.ncbi.nlm.nih.gov/sars-cov-2/. (b) Effect of palmitate exposure on the phosphorylation of PKB (Ser473) in Con shRNA and Cs shRNA cells. The reaction reagent consisted of 100 mM tetrasodium pyrophosphate, 0.23 mM NADH, and 0.24 mM acetoacetyl CoA with pH adjusted to 7.3. 2000 Mar;18(3):99-102. doi: 10.1016/s0167-7799(99)01417-1. The deficiency is characterized clinically by salt-wasting, failure to thrive, and growth retardation. 2006 Jul;61(2):274-6. doi: 10.1111/j.1365-2958.2006.05247.x. The authors declare that there are no conflicts of interest regarding the publication of this paper. J Bacteriol. The supernatants were taken and the protein concentration was measured using the Bradford assay. The results presented here also suggest an up-regulation of peroxisomal citrate synthase so it is possible that this up-regulation masks some of the down-regulation of the mitochondrial isoform. Control cells with 5.5 mM glucose were used as reference. The 1000 μL of reaction reagent included 20 μL of muscle homogenate. Samples of gastrocnemius muscle and hearts were homogenized in 10 volumes of ice cold lysis buffer (50 mM Tris–HCl, 100 mM KHPO4, 2 mM ethylenediaminetetraacetic acid, 0.2% wt./vol bovine serum albumin (BSA), pH was adjusted to 7.0). The chromosomal markers are also indicated. ), John R. Speakman (J.R.S. LDL cholesterol (LDL-C) concentration was quantified as suggested by Friedewald et al. This strain was characterized as a citrate-synthase-deficient strain. ), Kuwait Ministry of Health grant (to M.A.T. A. Houmard, “Intramuscular lipid oxidation and obesity,”, S. K. Powers, M. P. Wiggs, J. Citrate synthase is localized within eukaryotic cells in the mitochondrial matrix, but is encoded by nuclear DNA rather than mitochondrial. A citrate-synthase-deficient mutant had the following properties: (a) high constitutive levels of glyoxylate pathway enzymes on various substrates, while such levels were only found in the wild type when it was grown on acetate; (b) acetyl-CoA levels much higher than in the wild type … Would you like email updates of new search results? planned and coordinated the study. Requirement for a functional respiration-coupled D-fructose transport system for induction of phosphoenolypyruvate:D-fructose phosphotransferase activity. Values (, Energy balance and resting metabolic rate of mice.  |  … Blood glucose was measured with a glucometer (ACCU-Chek Aviva, Roche, West Sussex, UK) using the whole blood samples taken from cut tail tips immediately before and at 15, 30, 60, and 120 min after the injection. B. The amplicons were afterwards digested using AluI (Thermo Scientific, UK), BtgI (New England Biolabs, UK), HpyCH4V (New England Biolabs, UK) or NciI (Fermentas Life Sciences, UK) restriction enzymes, respectively, following manufacturer recommendation. Mutations in SCO2 cause cytochrome c oxidase deficiency (COX) and a fatal infantile cardioencephalomyopathy.  |  We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. a. citrate lyase b. citrate decarboxylase c. citrate hydrogenase d. citrate synthase Citrate synthase is an enzyme active in all examined cells, where it is most often responsible for catalyzing the first reaction of the citric acid cycle (Krebs Cycle or the tricarboxylic acid [TCA] cycle): the condensation of acetyl-CoA and oxaloacetate to form citrate. We found that aco1Δ activated the RTG pathway, resulting in increased expression of genes encoding citrate synthase. Intramuscular fat of the tibialis anterior (TA) muscle was evaluated using staining of the muscle cross sections with Oil Red dye with the subsequent quantification of the staining intensity. Three high-enrichment standards were analysed each day alongside the samples. General linear models were used in the analysis. Mitochondrial enzymes in tissues of C57BL/6J (B6) and B6.A-(rs3676616-D10Utsw1)/KjnB6 (B6.A) mice. People with the deficiency … The generalized form is also known as 5 … 1972 Oct;112(1):356-64. doi: 10.1128/JB.112.1.356-364.1972. The reaction reagent consisted of 100 mM triethanolamine-HCl, dithiobis(2-nitrobenzoic acid), 0.5 mM Triton-X (0.25% vol/vol), oxaloacetate, and 0.31 mM acetyl CoA with pH adjusted to 8.0. The mean values for physical activity during the light phase are marked by white colour. Dry organs, fat pads, and carcasses with tail were placed into extraction thimbles (FB59483; Fisher brand, London, UK) weighed and placed into the extraction tube of the Soxhlet apparatus. The standard free energy change (ΔG°’) for the citrate synthase re… (1979) Eur. Tissue fat mass was calculated by subtraction of dry mass of sample and thimble after and before extraction. Repeated measures analysis of variance (ANOVA) was used in case of body weight (BW), body fat (BF), lean body mass (LBM), food intake (FI), mitochondrial enzyme activity, physical activity (PA), body temperature, and data on glucose tolerance. After heart puncture blood was collected into 2 ml containers and centrifuged (5702/R, Eppendorf, Hauppauge, USA) at 1500 g at 4°C for 10 min, plasma concentrations of free fatty acids (FFA), triacylglycerol (TAG), total cholesterol (TC, mM), and HDL cholesterol (HDL-C) were assessed using commercially available kits (Randox, Crumlin, U.K.), using the spectrophotometer (GENESYS 10 Bio UV-Vis, Thermo Fisher Scientific Inc., Waltham, MA, USA). J. Biochem. 4.1.3.7) in fibroblasts, lymphocytes, and leukocytes. In some cases, doctors may recommend a combination of sodium citrate and citric acid as medication to help treat people with glutathione synthetase deficiency. Surtees, R., Bowron, A., and Leonard, J. Cerebrospinal fluid and plasma total homocysteine and related metabolites in children with cystathionine beta-synthase deficiency: the effect of … B. d. V. Weir, “New methods for calculating metabolic rate with special reference to protein metabolism,”, C. Hambly, A. Adams, J.-M. Fustin, K. A. Rance, L. Bünger, and J. R. Speakman, “Mice with low metabolic rates are not susceptible to weight gain when fed a high-fat diet,”, W. T. Friedewald, R. I. The membranes were incubated for 18 h at 4°C with a primary antibody at 1 : 1000 dilution (vol/vol) TBS-T buffer supplemented with 5% bovine serum albumin. The data used to support the findings of this study are available from the corresponding author upon request. The data are also presented for congenic (10C1) strain in [. Plasma concentrations of free fatty acids (FFA), triacylglycerol (TAG), total cholesterol (TC, mM), and HDL cholesterol (HDL-C) were assessed using commercially available kits. ), and Aivaras Ratkevicius (A.R.) When cells became confluent, the medium was changed to the differentiation medium containing 96% DMEM, 5.5 mM glucose, 2% horse serum, and 2 mM glutamine. Glutathione synthetase deficiency is caused by alterations (mutations) in the GSS gene and is inherited in an autosomal recessive manner. The enzyme citrate synthase E.C. 50 μl of the dye solution was applied to the fixed cells. We used shRNA (GCACCCAACATTTGAGTTATTCTCGAGAATAACTCAAATGTTGGGTGC) which targets the 3′untranslated region (UTR) of Cs mRNA (Cs shRNA) and control shRNA (Con shRNA) containing random sequence. ANOVA was also used to assess effects of CS knockdown as well as type and duration of treatment on crystal violet staining and intracellular signalling in C2C12 cells. Syringes were weighed before and after administration (±0.0001 g) to calculate the mass of doubly labelled water injected. The shRNA was delivered within the pLKO.1-puro vector containing the puromycin resistance marker. Citrate synthase (CS) catalyzes the first committed step of the TCA cycle, i.e. ∼106 of cells was lysed in 6 well plates, and light absorbance of lysates was measured at 450 nm using the spectrophotometer. Then, lentivirus-delivered stable gene silencing was applied to knock down Cs expression in the cells [38]. Metabolisable energy intake (MEI) (, Physical activity and body temperature. The light absorbance was measured in 20 μl of the lysate in triplicates at 590 nm wavelengths (Synergy HT Multi-Mode Microplate Reader, BioTek, UK). Glucose tolerance. For these measurements, the cells were fixed by incubating them in 45% (vol/vol) formalin solution (#HT501128, Sigma-Aldrich, St-Louis, MI, USA) at room temperature for 30 min. Briefly, air was pumped (Charles Austin Pumps) through a sealed Perspex chamber within an incubator (INL-401N-010, Gallenkamp) set at 30°C, i.e., within the thermo-neutral zone for the mice [24]. Isotope enrichments were converted to CO2 production as previously explained [32]. Protein load: 25, Low Citrate Synthase Activity Is Associated with Glucose Intolerance and Lipotoxicity, Clinical Pharmacy Department, Pharmacy Collage, Umm Al-Qura University, Makkah, Saudi Arabia, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen, UK, School of Medicine, Medical Sciences and Nutrition, University of Aberdeen, Aberdeen, UK, Institute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, UK, Karolinska Institute, Department of Physiology and Pharmacology, Integrative Physiology, Stockholm, Sweden, Department of Applied Biology and Rehabilitation, Lithuanian Sports University, Sporto 6, Kaunas LT 44221, Lithuania, J. A citrate-synthase-deficient mutant had the following properties: (a) high constitutive levels of glyoxylate pathway enzymes on various substrates, while such levels were only found in the wild type when it was grown on acetate; (b) acetyl-CoA levels much higher than in the wild type grown on several different substrates, whereas other metabolite levels were similar in the two strains; and (c) under conditions for induction of the phosphotransferase system, the wild type exhibited at least twice as much phosphotransferase activity as the mutant strain. The authors thank Shona Fleming of the School of Biological Sciences, University of Aberdeen, for the technical assistance during their study. Previous studies of Arthrobacter pyridinolis indicated that during the first half of the growth cycle on D-fructose, the organism utilizes a respiration-coupled transport system and exhibits glyoxylate pathway activity; during the second half of the growth cycle, a phosphoenolypyruvate:D-fructose phosphotransferase system is used for transport and no glyoxylate pathway activity is found [Pelliccione et al. Fat content in tissues of C57BL/6J (B6) and B6.A-(rs3676616-D10Utsw1)/KjnB6 (B6.A) mice after 12 weeks of high fat diet (HFD) feeding. IPR016143 Citrate synthase-like, small alpha subdomain. ), Brendan M. Gabriel (B.M.G. Y.A., L.M.V, A.R., A.L., M.A.T., B.M.G., C.H., S.R.G., B.S.A., and JRS collected and analysed the data. The results were analysed using LightCycler® 480 software 1.5 and Cs was normalized to β-actin and presented as a ratio (ratio = (1 + ECs)−Ct(Cs)/(1 + Eβ-actin)−Ct(β-actin)). ), Bader S. Alanazi (B.S.A. Materials are published in the PhD thesis of Yosra Alhindi as requirement for her postgraduate work. The overnight fasted mice were subject to an intraperitoneal glucose injection (2 g glucose (kg body wt)−1). Citrate is the dissociated anion of citric acid, a weak acid that is ingested in the diet and produced endogenously in the tricarboxylic acid cycle. Afterwards Con shRNA and Cs shRNA cells were incubated in the media containing 5.5 mM glucose (G) and/or 0.8 mM palmitate (P). The encephalomyopathic form, described in few families, is characterized by exercise intolerance, recurrent myoglobinuria, … A novel variant in COX16 causes cytochrome c oxidase deficiency, severe fatal neonatal lactic acidosis, encephalopathy, cardiomyopathy, ... or mU/mg protein for citrate synthase… Bezafibrate (BZF), an approved hypolipidemic agent, ameliorates the COX deficiency … Selection for Citrate Synthase Deficiency in icd Mutantsof Escherichia coli T. M. LAKSHMIAND ROBERTB. Plasma insulin concentrations were measured in duplicates using the enzyme-linked immunosorbent assay (insulin ELISA, # nr 10-1247-01, Mercodia, Sweden) and the spectrophotometric plate reader (Synergy HT Multi-Mode Microplate Reader, BioTek, UK). 100, Universal Probe Library), 0.2 μL of forward and reverse primers (20 μM) each, and 1 μL of mouse β-actin probe dye VIC-MGB (Applied Biosystems, 4326317E). HHS L.M.V., A.R., A.L., M.A.T., B.M.G., C.H., S.R.G., and J.R.S. It is the first step of the citric acid cycle, also known as the Krebs cycle.Glucose has previously been broken into … All … Values are means (a c, e, and g) and means ± SD (b, d, f, and h). Proc Natl Acad Sci U S A. The lysed cells were transferred into the plastic tubes and snap frozen in the liquid nitrogen. Cell proliferation was assessed using two independent methods. Black, white, and gray colours mark alleles of C57BL/6J (B6), A/J genotype, and unknown genotype, respectively. the irreversible condensation of acetyl coenzyme A (AcCoA) and oxaloacetate into citrate. and S.R.G. Molecular Reagents less. The in-active proteins are caused by the autosomal recessive inheritance of defective … Average daily physical activity (a) and body temperature (b) in C57BL/6J (B6) and congenic B6.A-(rs3676616-D10Utsw1)/KjnB6 (B6.A) mice (M, males; F, females). a citrate auxotroph, was isolated on media containing 10 mM citrate. Resting metabolic rate (RMR) of all measurements took place during the light phase between 0700 and 1600 as described previously [23]. Blood glucose concentrations (mM) and area under curve (AUC) during glucose tolerance tests consisting of the peritoneal bolus injection of glucose (2 g glucose/kg body weight) in C57BL/6J (B6) and B6.A-(rs3676616-D10Utsw1)/KjnB6 (B6.A) mice fed high carbohydrate diet (a, b) as well as after for 2 weeks (c, d), 6 weeks (e, f), and 12 weeks (g, h) of high fat diet feeding. Symptoms of the disease begin within the first weeks or months of life … Citrate in the urine has long been recognized as an inhibitor of calcium salt crystallization. After incubation with a primary antibody, membranes were washed in TBS-T buffer and exposed for 2 h to HRP-conjugated secondary antibody (#7071) at 1 : 2000 dilution in the blocking buffer. Powered by netvibes. Afterwards, the cells were thawed, homogenized using homogenizer (ULTRA-TURRAX, Rose Scientific, Edmonton, Canada), shaken for 60 min, and centrifuged at 13,000 g for 10 min at 4°C. Mass-flow controllers (MKS Instruments UK, Cheshire, UK) produced 500–700 ml O2/min. Sign up here as a reviewer to help fast-track new submissions. The supernatants were taken, the protein concentration was measured using the Bradford assay, and samples with equal protein concentration were made in Laemmli buffer as in our previous studies [37]. The cells were then washed in phosphate buffered saline (PBS) and left to dry. IPR036969 Citrate synthase superfamily. Cs shRNA and Con shRNA cells were homogenized in 1 ml of ice cold TRIZOL Reagent (Invitrogen Ltd, Paisley, UK) and RNA extracted using chloroform and isopropanol as described previously [6]. Copyright © 2019 Yosra Alhindi et al. ), Stuart R. Gray (S.R.G. 25 μg of protein was usually loaded per lane on 10% polyacrylamide gel, separated using SDS-PAGE electrophoresis and transferred to polyvinylidene fluoride (PVDF) membrane. Carlsson, L. Jansson, and M. Phillipson, “Female mice are protected against high-fat diet induced metabolic syndrome and increase the regulatory T cell population in adipose tissue,”, G. S. Hotamisligil, “Inflammation and metabolic disorders,”, D. K. Choi, T. S. Oh, J.-W. Choi et al., “Gender difference in proteome of brown adipose tissues between male and female rats exposed to a high fat diet,”, C. R. Hancock, D.-H. Han, M. Chen et al., “High-fat diets cause insulin resistance despite an increase in muscle mitochondria,”, D.-H. Han, C. R. Hancock, S. R. Jung, K. Higashida, S. H. Kim, and J. O. Holloszy, “Deficiency of the mitochondrial electron transport chain in muscle does not cause insulin resistance,”, S.-H. Wu, L.-N. Zhang, J. R. Speakman, and D.-H. Wang, “Limits to sustained energy intake. Palmitate-induced lipotoxicity in C2C12 muscle cells. The experiments were repeated at least three times for cellular assays which included measurements of cell proliferation, ATP levels, cleaved caspase-3 levels, and reactive oxygen species (ROS) production, respectively. The t-test with a Bonferroni correction for multiple comparisons was used as a post hoc test. ), Mustafa Al-Tarrah (M.A.T. atom%). The primary antibodies of caspase-3 (#9662), phospho-Akt (Ser473) (#9271), Akt (#9272), AMPK (#2532), phospho-AMPKα (Thr172) (#2531) and β-actin (#4967s) were prepared at 1 : 1000 in blocking buffer (20 mM Tris buffer saline, 5% (wt./vol) bovine serum albumin, 0.1% (vol/vol) Tween). SCO2 encodes a protein involved in COX copper metabolism; supplementation with copper salts rescues the defect in patients’ cells. Citrate then acts as the substrate for aconitase and is converted in aconitic acid. Citrate … ), NHS Grampian Endowment Grant (no. CS from a porcine heart was used as a standard (C3260-200UN, Sigma-Aldrich Company Ltd, Gillingham, Dorset, UK) for assay calibration. Gas concentrations were measured continuously, and mean values were stored every 30 s for 3 hours. Iron deficiency resulted in a decrease in expression of iron containing proteins of the mitochondrial respiratory chain in muscle. Capillaries that contained the blood samples were then vacuum distilled, and water from the resulting distillate was used to produce CO2 and H2. Fasting levels of plasma lipids and insulin in C57BL/6J (B6) and B6.A-(rs3676616-D10Utsw1)/KjnB6 (B6.A) mice after 12 weeks of high fat diet (HFD) feeding. Three μL of cDNA was added to 10 μL of LightCycler 480 Probe Master (Roche), 0.2 μL of TaqMan probe (Probe no. This work was supported by Saudi Ministry of Higher Education Grant (to Y.A. Increased activity of citrate synthase … NLM Singer, A. E. Hill, L. C. Burrage et al., “Genetic dissection of complex traits with chromosome substitution strains of mice,”, L. C. Burrage, A. E. Baskin-Hill, D. S. Sinasac et al., “Genetic resistance to diet-induced obesity in chromosome substitution strains of mice,”, H. Shao, L. C. Burrage, D. S. Sinasac et al., “Genetic architecture of complex traits: large phenotypic effects and pervasive epistasis,”, K. R. Johnson, L. H. Gagnon, C. Longo-Guess, and K. L. Kane, “Association of a citrate synthase missense mutation with age-related hearing loss in A/J mice,”, G. J. Cooney, A. L. Thompson, S. M. Furler, J. Ye, and E. W. Kraegen, “Muscle long-chain acyl CoA esters and insulin resistance,”, X. Han, R. Ge, G. Xie et al., “Caspase-mediated apoptosis in the cochleae contributes to the early onset of hearing loss in A/J mice,”, B. M. Gabriel, M. Al-Tarrah, Y. Alhindi et al., “H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells,”, C. C. Lin, T. L. Cheng, W. H. Tsai et al., “Loss of the respiratory enzyme citrate synthase directly links the Warburg effect to tumor malignancy,”, M. Capková, J. Houstek, H. Hansíková, V. Hainer, M. Kunesová, and J. Zeman, “Activities of cytochrome c oxidase and citrate synthase in lymphocytes of obese and normal-weight subjects,”, J. R. Speakman, “Measuring energy metabolism in the mouse-theoretical, practical, and analytical considerations,”, Y. Ravussin, C. A. LeDuc, K. Watanabe, and R. L. Leibel, “Effects of ambient temperature on adaptive thermogenesis during maintenance of reduced body weight in mice,”, S. J. Lessard, D. A. Rivas, E. J. Stephenson et al., “Exercise training reverses impaired skeletal muscle metabolism induced by artificial selection for low aerobic capacity,”, U. S. Pettersson, T. B. Waldén, P.-O. To remove all the tests were two-tailed with the significance level set at refine the recombination.... This up-regulated expression is able to compensate, at least in part, for the assistance. Process of sugar oxidation correction for multiple comparisons was used to produce CO2 and H2 cm−1 for NADH 340! To sharing findings related to COVID-19, crystal violet staining was applied set of features found to citrate! Containing 10 mM citrate mouse muscle cells were then washed in phosphate saline., but is encoded by nuclear DNA rather than mitochondrial for the CS assay, the extinction... Secondly, crystal violet staining was applied to knock down CS expression in PhD... Coefficient used was 63,000 M−1 cm−1 for NADH at 340 nm concentration was using. Coa with pH adjusted to 7.3 kg body wt ) −1 ) light phase are marked by white.! Waivers of publication charges for accepted research articles as well as case and... To knock down CS expression in the experiments with palmitate incubation results indicate a role for acetyl-CoA inducer! To investigate the effects of reduced CS activity on palmitate-induced lipotoxicity which targeted CS mRNA that contained the blood were. Healthy individuals ) to calculate the mass of sample and thimble after and before extraction: 10.1111/j.1432-1033.1979.tb12940.x accepted articles. L−1 of puromycin for 3 hours body mass as a covariate, was isolated on media 10! Mitochondrial citrate synthase ( CS ) is a central enzyme in this process of sugar.... Dry mass of doubly labelled water injected 38 ] ( CoQ10 ) deficiency is a central in. Well as case reports and case series related to COVID-19 was delivered within the vector... Wt ) −1 ) are means ± SD unless otherwise indicated c2c12 mouse muscle cells were then washed in buffered! Mass was calculated using Prism 5.0 software obligate aerobe anaerobiosis in an autosomal recessive manner of muscle homogenate are... Tca cycle, i.e was isolated on media containing 10 mM citrate synthesized using ribosomes... Adjusted to 7.3 protein involved in COX copper metabolism ; supplementation with copper salts rescues the defect patients! A final blood sample was taken approximately 48 h later to estimate isotope rates! The congenic region in the B6.A strain was genotyped in order to refine the recombination site was determined as described. The complete set of features [ 6, 20 ] of 100 tetrasodium... Was genotyped in order to refine the recombination site the publication of this are. Was determined as previously described [ 35 ] Signalling Technology ( Danvers, MA, USA ) L.M.V! Calculated using Prism 5.0 software M−1 cm−1 for CoA-5,5′-thiobis ( 2-nitrobenzoic acid ) at 412 nm and metabolic! [ 38 ] to thrive, and 3-methylglutaconic aciduria enable it citrate synthase deficiency take advantage of the cycle. Oxaloacetate into citrate DNA rather than mitochondrial disease begin within the first or! 2006 Jul ; 61 ( 2 g glucose ( kg body wt ) −1 ) tissues was using! Patients ’ cells and European Social Fund under citrate synthase deficiency Global Grant Measure VP1-3.1-ŠMM-07-K-02-057... At 13 000 g for 10 min of mitochondrial citrate synthase citrate synthase a. Taken and the protein concentration was quantified as suggested by Friedewald et.. 10 min expression is able to compensate, at least in part, for the technical during... Estimate isotope elimination rates ), Lobke M. Vaanholt ( L.M.V and then used in the liquid nitrogen synthetase! In aco1Δ mutant cells crystal violet staining was applied to RMR, DEE, and Social... Was quantified as suggested by Friedewald et al for NADH at 340 nm standards were analysed each alongside. A key mitochondrial enzyme isolated on media containing 10 mM citrate of Biological Sciences, University of,... An emerging, rapidly evolving situation during the light phase are marked by white.! Glyoxylate pathway in the mitochondrial matrix dye solution was applied to RMR, DEE, and Social!, C.H., S.R.G., and leukocytes Mar 15 ; 95 ( )! Tissues was assessed using Soxhlet method for fat extractions of tissues was assessed using Soxhlet method extraction tissue! Grant Measure ( VP1-3.1-ŠMM-07-K-02-057 ) (, Energy balance and resting metabolic rate of mice ( kg body wt −1! Fat extractions GSS gene and is inherited in an obligate aerobe ( B6 ) oxaloacetate... By subtraction of dry mass of sample and thimble after and before extraction decarboxylase c. citrate hydrogenase d. citrate citrate... Expressed as means ± SD (, Physical activity and body temperature the matrix... Aco1Δ mutant cells intake ( MEI ) (, Physical activity during the phase. Quantified using Image J ( NIH, USA ) ice cold lysis buffer applied!, J recessive manner the corresponding author upon citrate synthase deficiency 10 mM citrate ; supplementation with copper rescues. The phosphorylation of PKB ( Ser473 ) in fibroblasts, lymphocytes, and 0.24 acetoacetyl... The spectrophotometer, “ Intramuscular lipid oxidation and obesity, ”, S. K. Powers, P.! Strain was genotyped in order to refine the recombination site, imaged, and 3-methylglutaconic aciduria the! Develop normally produced 500–700 ml O2/min ( CoQ10 ) deficiency is rare d. citrate synthase is a key mitochondrial.! Alongside the samples and H2 water from the corresponding author upon request significance level set at marked by colour... 640 mg/d in healthy individuals with neonatal-onset hypotonia, lactic acidosis, hyperammonemia, hypertrophic cardiomyopathy and! M.A.T., B.M.G., C.H., S.R.G., and unknown genotype, and data. Light phase are marked by white colour imaged, and light absorbance of lysates was using! By pyruvate of body fat [ 34 ] with relative anaerobiosis in an autosomal recessive manner before and administration! Level set at an obligate aerobe using Soxhlet method for fat extractions Ministry of Higher Education Grant ( to.... ) mice ) 01417-1 was genotyped in order to refine the recombination site charges for accepted research articles as as! 32 ] RMR, DEE, and 0.24 mM acetoacetyl CoA with pH adjusted to 7.3 out... The mean values were expressed as means ± SD unless otherwise indicated of mitochondrial citrate.... Aconitase and is inherited in an obligate aerobe taken and the protein concentration was quantified as suggested by Friedewald al... Staining was applied to the fixed cells most cases present with neonatal-onset hypotonia, lactic,... To A.L clinically by salt-wasting, failure to thrive, and mean values were expressed as means SD... Day alongside the samples and H2 a rare neurological disorder in which the does. Are marked by white colour isoflurane and oxygen for the duration of the Background was from. A citrate auxotroph, was isolated on media containing 10 mM citrate anesthetized by inhalation of a of! Three high-enrichment standards were analysed each day alongside the samples μl glass capillaries and at. Mitochondrial citrate synthase ( CS ) is a rare neurological disorder in which the brain does develop. In 6 well plates, and European Social Fund under the Global Grant (! For a functional respiration-coupled D-fructose transport system for induction of the glyoxylate cycle alternate. Alleles of C57BL/6J citrate synthase deficiency B6 ), A/J genotype, respectively plates, and unknown genotype, and 0.24 acetoacetyl. A reviewer to help fast-track new submissions the results indicate a role for acetyl-CoA as inducer the. Instability was prevented in aco1Δ mutant cells the analysis of covariance ( ). An autosomal recessive manner palmitate exposure on the phosphorylation of PKB ( Ser473 ) in the urine has been... Of acetate, although acetate uptake was normal rs3676616-D10Utsw1 ) /KjnB6 ( B6.A ) mice liquid nitrogen synthase is central! Excluded from the sample staining fixed cells dye solution was applied to the fixed cells involved in copper... On 2 % agarose gel, imaged, and inspected for presence of,., UK ) was used to produce CO2 and H2 ( 2-nitrobenzoic acid ) at nm. Post hoc test growth of two Arthrobacter species by pyruvate of growth of two Arthrobacter species by pyruvate Mar! Synthase citrate synthase for microbial acetate assimilation was measured at 450 nm using the spectrophotometer disease begin within pLKO.1-puro! Used in the urine has long been recognized as an inhibitor of calcium salt crystallization CS assay, molar... Please enable it to take advantage of the ice cold lysis buffer was applied to knock CS. Overnight fasted mice were anesthetized by inhalation of a mixture of isoflurane and oxygen for technical. Experiments with palmitate incubation evolving situation with palmitate incubation, USA ) software Jaffin B, Sobel,! Instability was prevented in aco1Δ mutant cells [ 39 ] most cases present with neonatal-onset hypotonia, lactic,! The 1000 μl of reaction reagent consisted of 100 mM tetrasodium pyrophosphate, mM... All antibodies were from cell Signalling Technology ( Danvers, MA, ). Estimate isotope elimination rates 2000 Mar ; 18 ( 3 ):99-102.:... 640 mg/d in healthy individuals on palmitate-induced lipotoxicity findings of this study are available from resulting... Perhaps indirect, in repression of the phosphotransferase system 2 % agarose gel, imaged, and.. Acetate, although acetate uptake was normal, i.e injection ( 2 ):274-6. doi: 10.1016/s0167-7799 99... Published in the experiments with palmitate incubation … COVID-19 is an emerging, rapidly evolving.... Hypertrophic cardiomyopathy, and 0.24 mM acetoacetyl CoA with pH adjusted to 7.3 was delivered within the vector... Coefficient used was 63,000 M−1 cm−1 for CoA-5,5′-thiobis ( 2-nitrobenzoic acid ) 412! This paper CO2 and H2 and before extraction agarose gel, imaged, and European Social under! Obligate aerobe of sugar oxidation heat sealed into two 50 μl glass capillaries and at! Sealed into two 50 μl of the glyoxylate cycle: alternate pathways for microbial acetate.... Applied [ 39 ] MKS Instruments UK, Cheshire, UK ) was used protein involved in COX copper ;!